JCM On-line Catalogue of Strains

 Scientific name 1
 Genus:
 Species:
    Example 1: Genus = Micromonospora
Example 2: Species = aurantiaca
Example 3: Genus = %monospo, Species = %ensis
(Prefix match search at each box. Inside match or suffix match search can be performed by using "%" as a wild-card character like Example 3. Case-insensitive)

 Scientific name 2
 Scientific name:
    Example 1: Scientific name = Micromonospora chalcea
Example 2: Scientific name = Lactobacillus paracasei subsp. paracasei
(Prefix match search. Inside match or suffix match search can be performed by using "%" as a wild-card character. Case-insensitive)

 JCM accession number
   JCM:
    Example: JCM = 12345 (Exact match search)

 Accession number of other culture collection
 Acronym:
 Number:
    Example 1: Acronym = DSM, Number = 43067
Example 2: Acronym = VKM, Number = Ac-636
(Exact match search at both boxes. Case-sensitive)

 Keyword
   Keyword:
    Example: Keyword = genome sequence
(Inside match search. Case-insensitive)

 Culture medium
 JCM Medium No.:
 Name of Medium:
    Example 1: JCM Medium No. = 58
Example 2: Name of Medium = malt extract
(Exact match search for "JCM Medium No." and inside match search for "Name of Medium". Case-insensitive)

Quality control of JCM strains

JCM commonly performs quality checks of each strain as described below at the time of its acceptance and, preservation at JCM. JCM also performs quality tests of the holdings when necessary. JCM does not verify characteristics and/or functions cited in the on-line catalogue. JCM is not responsible for any differences between the properties of the strain deposited in JCM and properties provided in the literature, database and any information sources. Users are recommended to check the properties necessary for their researches by themselves.

  • Performed
    • Acceptance test
    • Every strain deposited in JCM is subcultured at JCM, and its viability, purity, colony appearance and cell morphology are checked by microscopic and/or macroscopic observations. At the same time, a DNA sequence of a PCR-amplified fragment such as that of the rRNA gene is determined and compared with the sequence provided by a depositor of the strain to confirm the authenticity of the received culture. This DNA sequence check at the time of acceptance has been performed since 2011. Archaeal strains deposited after 2015 have been checked also if there is bacterial contamination by the PCR analysis under the same experimental condition for the bacterial 16S rRNA gene amplification.

    • Preservation test
    • Viability and purity of each batch are confirmed after preservation by the freezing, freeze-drying and/or L-drying methods.

  • Not performed
  • Characteristics and/or functions of each strain appearing in the on-line catalogue are based on information from the corresponding literature and not examined by JCM.

  • Supplementary tests
  • When any other tests are performed, the results are shown in the on-line catalogue.


Method for DNA sequence check

The standard protocol for the DNA sequence check performed at JCM is as follows:

(1) Preparation of cell extract
(2) PCR
(3) DNA sequencing

Materials:

  • FastPrep-24 (MP Biomedicals), heat-sterilized acid-washed glass beads (SIGMA G4649 [≤106 µm]), a 2.0 mL screw-cap tube (e.g. AS ONE C-2.0) for cell disruption.
  • MultiScreen PCR96 filter plate (Merck-Millipore MSNU03010), MonoFas DNA purification kit I (GL Sciences) for DNA purification.
  • TaKaRa Ex Taq® Hot Start Version (Takara Bio), and other reagents, buffers, and instruments for PCR and DNA analysis.

(1) Preparation of cell extract

  1. Add 0.3 g grass beads and 400 µL TE buffer in a 2.0 mL screw-cap tube and suspend an appropriate amount of microbial cells.
  2. Disrupt cells using FastPrep-24, usually at speed 6 for 20 sec.
  3. Centrifuge and precipitate the cell debris. Transfer the supernatant into a new tube.
  4. The supernatant is purified or concentrated with MonoFas, if necessary.

(2) PCR

  1. Crude cell extract or its purified solution is used as template for PCR after diluting appropriately.
  2. Amplify the gene fragment with the reaction mixture, the PCR primers and the cycle condition described in Tables 1-4.
  3. Electrophorese the PCR product and confirm its amount.

(3) DNA sequencing

  1. Purify the PCR product with a DNA purification kit such as MultiScreen or MonoFas.
  2. Determine DNA sequence according to the instruction of DNA sequencer. For the DNA sequencing primer, choose appropriate one among those shown in Table 2.
  3. Correct DNA sequence data, if necessary, and compare with the data from the depositor. Compare also with the database sequences using the BLAST service provided by e.g. NCBI, if appropriate.

 
Table 1. PCR mixture

Reagent Volume (µL)
Milli-Q Water 37.75
10 x Buffer 5.0
dNTPs (2.5 mM) 4.0
Forward primer (10 µM) 1.0
Reverse primer (10 µM) 1.0
TaKaRa Ex Taq® HS 0.25
Template DNA 1.0

Total reaction volume 50 µL.

 
Table 2. Primers used in PCR amplificaion and sequencing

Primer Sequence (5’–3′) Target Group
27F1 AGAGTTTGATCCTGGCTCAG Bacteria
786F2 GATTAGATACCCTGGTAG Bacteria
1492R3 GGTTACCTTGTTACGACTT Bacteria
907R1 CCGTCAATTCMTTTRAGTTT Bacteria
826R4 GACTACCAGGGTATCTAATCC Bacteria
519R1 GWATTACCGCGGCKGCTG Bacteria/Archaea
530F1 GTGCCAGCMGCCGCGG Bacteria/Archaea
1053F2 GCATGGCYGYCGTCAG Bacteria/Archaea
A21F5 TTCCGGTTGATCCYGCCGGA Archaea
A348F6 TCCAGGCCCTACGGG Archaea
A1400R7 GACGGGCGGTGTGTGC Archaea
A1100R7 CGGGTCTCGCTCGTT Archaea
ITS58 GGAAGTAAAAGTCGTAACAAGG Fungi
ITS38 GCATCGATGAAGAACGCAGC Fungi
NL19 GCATATCAATAAGCGGAGGAAAAG Fungi
NL49 GGTCCGTGTTTCAAGACGG Fungi
ITS48 TCCTCCGCTTATTGATATGC Fungi
ITS28 GCTGCGTTCTTCATCGATGC Fungi

 
Table 3. PCR primer sets

Target Group Primer set Target gene
Bacteria 27F + 1492R 16S rRNA
Archaea A21F + A1100R 16S rRNA
Archaea A21F + A1400R 16S rRNA
Fungi ITS5 + NL4 ITS, LSU
Fungi ITS5 + ITS4 ITS
Fungi NL1 + NL4 LSU

 
Table 4. PCR cycling condition

Step Temp. (°C) Time
1 98 2 min.
2 98 10 sec.
3 53 20 sec.
4 72 60 sec.
5 Followed steps 2-4 by 30 to 35 cycles
6 72 5 min.
7 10 hold

 
Reference

  1. Lane, D. J. (1991). 16S/23S rRNA sequencing, In: Stackebrandt, E. and Goodfellow, M. (eds.), Nucleic Acid Techniques in Bacterial Systematics, pp. 115–176, Jon Wiley & Sons, Chichester.
  2. Baker, G. C., Smith, J. J., and Cowan, D. A. (2003). Review and re-analysis of domain-specific 16S primers. J. Microbiol. Methods 55: 541–555.
  3. Turner, S., Pryer, K. M., Miao, V. P., and Palmer, J. D. (1999). Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J. Euk. Microbiol. 46: 327–338.
  4. Youssef, N., Sheik, C. S., Krumholz, L. R., Najar, F. Z., Roe, B. A., and Elshahed, M. S. (2009). Comparison of species richness estimates obtained using nearly complete fragments and simulated pyrosequencing-generated fragments in 16S rRNA gene-based environmental surveys. Appl. Environ. Microbiol. 75: 5227–5236.
  5. DeLong, E. F. (1992). Archaea in coastal marine environments. Proc. Natl. Acad. Sci. USA 89: 5685–5689.
  6. Achenbach, L. and Woese, C. (1995). Appendix 6. 16S and 23S rRNA-like primers, In: Robb, F. T. and Place, A. R. (eds.), Archaea: a Laboratory Manual. Thermophiles, pp. 201-203, Cold Spring Harbor Laboratory Press, New York.
  7. Itoh, T., Suzuki, K., and Nakase, T. (1998). Occurrence of introns in the 16S rRNA genes of members of the genus Thermoproteus. Arch. Microbiol. 170: 155–161.
  8. White, T. J., Bruns, T., Lee, S., and Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (eds.), PCR Protocols: A Guide to Methods and Applications, pp. 315-322, Academic Press, New York.
  9. O’Donell, K. (1993). Fusarium and its near relatives, In: Reynolds, D. R. and Taylor, J. W. (eds.), The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics, pp. 225-233, CAB International, Wallingford.